Update profile
    Change password
    Sign out

Our content has moved! Check out our protein biology page on lifetechnologies.com  Go now >

Cell-free in vitro Protein Expression

In vitro protein expression is the production of recombinant proteins in solution using biomolecular translation machinery extracted from cells. Because protein synthesis occurs in cell lysates rather than within cultured cells, the method is also called cell-free protein expression. Cell-free protein production can be accomplished with several kinds and species of cell extract, and these approaches have several advantages and features that complement traditional in vivo methods.

Page Contents:

Protein Methods Library Home

Introduction to In Vitro Protein Expression

In vitro protein expression (also known as in vitro translation, cell-free protein expression, cell-free translation, or cell-free protein synthesis) is a technique that enables researchers to rapidly express and manufacture small amounts of functional proteins. Compared to in vivo techniques based on bacterial or tissue culture cells, in vitro protein expression is considerably faster because it does not require gene transfection, cell culture or extensive protein purification.

Although in vitro expression is not practical for commercial large-scale recombinant protein production, it has a variety of features that make it considerably more useful and flexible for many research applications.

Applications for which cell-free protein expression is ideal:

  • Experiments to characterize protein-protein interactions and protein-nucleic acid interactions
  • Rapid and high-throughput expression of mutant or truncated proteins for functional analysis
  • Expression of mammalian proteins with proper glycosylation and native post-translational modifications (PTM)
  • Labeling of proteins with stable isotopes for structural analysis
  • Production of functional virons or toxic polypeptides
  • Analysis of components required for protein folding, protein stability or protein degradation

Learn more...

Overview of protein expression

Cell lysis (protein extraction)


View products...

Recombinant Proteins

Azido-Sugars for Metabolic Glycoprotein Labeling

SILAC Kits for Stable Isotope Labeling

Photo-reactive Amino Acids for Metabolic Labeling and Crosslinking

Template + Cell Extract = Protein Synthesis

Two basic components are needed to accomplish in vitro protein expression: (1) the genetic template (mRNA or DNA) encoding the target protein and (2) a reaction solution containing the necessary transcriptional and translational molecular machinery. Cell extracts supply all or most of the molecules of the reaction solution, including:

  • RNA polymerases for mRNA transcription
  • ribosomes for polypeptide translation
  • tRNA and amino acids
  • enzymatic cofactors and an energy source
  • cellular components essential for proper protein folding

Cell lysates provide the correct composition and proportion of enzymes and building blocks required for translation. (Usually, an energy source and amino acids must also be added to sustain synthesis.) Cell membranes are removed to leave only the cytosolic and organelle components of the cell (hence the term, “cell-free extracts”). The first types of lysates developed for cell-free protein expression were derived from prokaryotic organisms. More recently, systems based on extracts from insect cells, mammalian cells and human cells have been developed and made commercially available.

Cell Extracts for In Vitro Protein Translation

Types of Cell-free Extracts

Extracts used for cell-free protein expression are made from systems known to support high level protein synthesis. The first known cell-free extracts capable of supporting translation were made from E. coli. Advances in the field led to development of eukaryotic in vitro translational systems from rabbit reticulocyte lysates (RRL), wheat germ extracts, and insects cell (such as SF9 or SF21) lysates. Extracts made from these eukaryotic systems contain all the necessary cellular macromolecules like ribosomes, translation factors and tRNAs required for efficient protein synthesis (an energy source and amino acids must be supplemented).

Lysates from E. coli and wheat germ are devoid of endogenous genetic messages. By contrast, lysates made from rabbit reticulocytes and insect cells contain endogenous mRNAs that can be translated during the synthesis reaction. These lysates are pretreated with micrococcal nuclease to support translation of only an exogenously supplied message. Once endogenous genes and transcripts are removed, inhibitors for the enzyme RNase are supplemented to prevent further mRNA degradation.

PTM and Human Proteins

Although cell-free systems based on E. coli, RRL and wheat germ extracts provide some benefits over traditional in vivo protein expression, they are nonetheless limited in their ability to produce human proteins complete with post-translational modifications (PTMs). Cell-free systems from E. coli and wheat germ extracts are not capable of protein glycosylation. With rabbit reticulocyte systems, canine microsomal membranes must be added to the translation mix to produce glycosylated proteins but decrease overall protein yield. Glycosylated protein yields from insect cell-free systems are higher than from RRL systems, but the glycosylation patterns obtained are different from those produced by human cells.

Our researchers have optimized a cell-free expression system based on extracts from human cell lines. (The current commercialized system uses HeLa cell lysates, although other cell lines have been used to optimize various certain outcomes.) The strategy enables the use of lysates capable of providing proper post-translational modifications with protein yields that are higher those from other mammalian cell-free systems.

Learn more...
Overview of Thermo Scientific Human In Vitro Translation Systems

View products...
Thermo Scientific 1-Step Human IVT Kits

Learn more...
Glycoprotein expression in a human IVT system

Comparison of in vitro (cell-free) protein expression systems. Advantages and disadvantages of existing extract-based systems for human recombinant protein synthesis. Selection of a cell-free expression system should consider the biological nature of the protein, application, and the template used for protein expression.
System Advantages Disadvantages
E. coli
  • Very high protein yield
  • Relatively tolerant of additives
  • Many eukaryotic proteins insoluble upon expression
  • Eukaryotic co- and post-translational modifications not possible
  • Codon usage is different from eukaryotes
Rabbit Reticulocyte (RRL)
  • Mammalian system
  • Cap independent translation
  • Sensitive to additives
  • Protein glycosylation not possible
  • Co-expression of off-target proteins
Wheat germ
  • Translation of large proteins possible
  • Devoid of off-target endogenous mammalian proteins
  • High protein yield
  • Mammalian co- and post-translational modifications are not possible
  • Premature termination of products
  • Translation of large proteins possible
  • No endogenous mammalian proteins
  • Certain forms of protein glycosylation possible
  • Non-mammalian
  • Human system
  • Co- and post-translational modifications are possible
  • Synthesis of functional proteins
  • Possible to make VPLs (virus-like particles)
  • Sensitive to additives
  • Lower yields than E. coli
  • New system

Transcription and Translation in Cell-free Expression

Linked vs. Coupled Expression Reactions

Cell-free expression systems can support protein synthesis from DNA templates (transcription and translation) or mRNA templates (translation only). In principle, cell-free expression systems can be designed to accomplish transcription and translation steps as two separate sequential reactions (linked) or concurrently as one reaction (coupled).

Thermo Scientific 1-Step Human IVT Kits use the coupled format and are optimized for protein expression from DNA templates. However, protocols for using these same reagents for mRNA (translation-only) are available.

View products...
Thermo Scientific 1-Step Human IVT Kits

Learn more...
Protocol for in vitro protein expression using mRNA templates

Schematic of the 1-Step Coupled Human IVT Kit for DNA
Protocol summary for the 1-Step Human Coupled IVT Kit. Simply add the appropriate template to a mixture of HeLa cell lysate, Accessory Proteins, Reaction Mix and incubate at 30°C for 90 minutes for protein yields up to 100µg/mL. Smaller reactions are ideal for expression of mutational variants in a microplate format. The reaction volumes and times can be increased to express larger amounts of a single protein for use in several downstream applications.



In vitro Transcription

Template DNA for in vitro transcription can be linear, a circular plasmid or a PCR fragment. However, the DNA must contain a promoter sequence upstream of the gene to be transcribed. DNA-dependent RNA polymerases (RNA Pol) use specific DNA-sequences or elements to identify and bind the promoter regions in genes to initiate transcription. Certain RNA Pols have only one subunit (e.g., those from bacteriophages like T3 and T7, and mitochondria), while other RNA Pols from bacteria and eukaryotes are multi-subunit enzymes that require additional protein factors for efficient transcription. The multimeric enzymes are difficult to reconstitute from purified subunits. By contrast, the smaller monomeric RNA Pols from bacteriophages can perform transcription, including termination and release of the transcript from a DNA template, without the aid of additional protein factors. These features make the bacteriophage RNA Pols excellent tools for in vitro transcription reactions.

Three different phage RNA Pols with distinct DNA sequence specificities are available commercially for in vitro transcription:

  • T7 RNA polymerase
    (Promoter sequence: TAATACGACTCACTATAGGG)
  • T3 RNA polymerase
    (Promoter sequence: AATTAACCCTCACTAAAGGG)
  • SP6 RNA polymerase
    (Promoter sequence: AATTTAGGTGACACTATAGAA)

Cloning vectors with the promoter sequences for a particular bacteriophage RNA polymerases are available commercially. These cloning vectors contain multiple cloning sites downstream of the promoter sequences where the gene of interest can be inserted and used as a template for in vitro transcription. Alternatively, transcription can be performed on DNA template generated by PCR using gene-specific primers containing the promoter sequences at the 5’ end of the upstream (or forward) gene-specific primer.

To generate transcripts of mature mRNA for translation, additional features are required. Prokaryotic systems require the ‘Shine-Dalgarno’ sequence to assist in proper translation. Eukaryotic systems require pre-mRNA processing to create a mature mRNA. This includes:

  • Addition of a ‘Cap’ structure at the 5’ end of message and or an IRES element upstream of the translation initiation site for eukaryotic cell-free translation systems.
  • Addition of a Kozak sequence upstream of the initiation codon to assist in translation of the correct reading frame.
  • Addition of a poly-adenine sequence at the 3’ end, downstream of the translation termination codon.
  • Splicing to remove mRNA introns, leaving only exons which code for the target protein.

In living cells, these modifications occur post-transcriptionally and are required before mRNA is exported from the nucleus to the cytoplasm for translation. Despite the complexities of eukaryotic pre-mRNA prossessing, these changes significantly enhance mRNA stability, translation efficiency and accuracy.

For in vitro expression, these sequence elements can be incorporated into the starting DNA vector so that the immediate product of transcription is equivalent to a mature mRNA. To assist in cloning genes to incorporate the proper sequences, vectors containing elements optimized for transcription and translation of either prokaryotic or eukaryotic cell-free expression systems are commercially available.

View products...
Human In Vitro Translation Kits and Reagents

pT7CFE1 Expression Vectors

Learn more...
Getting Started with Human in vitro Translation

In vitro Translation

By contrast with the transcriptional machinery discussed above, translational machinery involves too many complex components to supply individually as purified molecules. Whole cell extracts provide the only practical means of supplying the translation apparatus needed for "reading" the message of a mature mRNA and generating a polypeptide in vitro. The same is true of the enzymes and factors required to execute post-translational modifications.

Nevertheless, supplying most of the necessary components in the form of cell extracts does not eliminate the opportunity or value of supplementing translation reaction mixtures with selected additives. Indeed, to improve protein yields, the extracts are typically supplemented with amino acids and an energy source to fuel protein expression. When conditions are optimized, functional protein can be synthesized in useful quantities for numerous downstream applications in about one hour. The only requirement needed outside of the reaction mixture is an incubator to sustain optimal enzyme activity.

Depending on the system, the protein translated can be further processed to resemble the protein state found in vivo. This includes proper protein folding, amino acid processing, and other post-translational modifications that regulate the biology of the protein. Typically, systems derived from lower organisms such as bacteria provide little to no protein processing, which is evident by the reoccurring problem of protein insolubility and inclusion body formation.

Learn more...
Overview of Thermo Scientific Human In Vitro Translation Systems

Getting Started with Human in vitro Translation


  1. Imataka, H., Mikami, S. (2009). [Advantages of human cell-derived cell-free protein synthesis systems]. Seikagaku. 81(4):303-7. Review. Japanese. PubMed PMID: 19462838.
  2. Mikami, S., et al. (2008). A human cell-derived in vitro coupled transcription/translation system optimized for production of recombinant proteins. Protein Expr Purif. 62(2):190-8. PubMed PMID: 18814849.
  3. Kobayashi, T., et al. (2007). An improved cell-free system for picornavirus synthesis. J Virol Methods. 142(1-2):182-8. PubMed PMID: 17320977.
  4. Mikami, S., et al. (2006). A hybridoma-based in vitro translation system that efficiently synthesizes glycoproteins. J Biotechnol. 127(1):65-78. PubMed PMID: 16889861.
  5. Mikami, S., et al. (2006). An efficient mammalian cell-free translation system supplemented with translation factors. Protein Expr Purif. 46(2):348-57. PubMed PMID: 16289705.

Written and/or reviewed by Douglas Hayworth, Ph.D.

Instructions | MSDS | CofA
Product Instructions | MSDS | CofA  

Recommend this page

Follow Us
Email Sign-up  Email Announcements


Antibodies  |   Molecular Biology   |   Cell Biology   |  Thermo Scientific  |   * Trademarks  |   Privacy Statement
© 2015 Thermo Fisher Scientific Inc.   |   3747 N Meridian Rd, Rockford, IL USA 61101   |   1-800-874-3723  or  815-968-0747